Generation of homozygous Fsip1 null mice
The Fsip1 null mice line (Fsip1−/−) was generated on C57BL/6J genetic background by non-homologous end joining (NHEJ) using CRISPR/Cas9 technology. The Fsip1 gene (ENSMUSG00000027344) is located on the chromosome-2 (Chr2:118130424-118256966 bp), contains 11 exons. Cas9 mRNA and small guide RNAs (sgRNA) were performed as previously described elsewhere [26]. Four sgRNAs targeting the 3rd exon of Fsip1 gene were designed (Fig. 1 A). The mixture of Cas9 mRNA and sgRNA was injected into fertilized embryos of super-ovulated C57BL/6J female mouse. The injected zygotes were cultured in vitro at 37 °C and 5% CO2, and the obtained blastocysts were then transferred into the uterus of pseudo pregnant C57BL/6J female mouse. In order to determine the genotype of the offspring, PCR was carried out with genomic DNA. The primers used were as follows: forward: 5' CCCTGGGGTGTATCTGCTTCTA ' and reverse: 5' GGCTGGCTTACTCACCATTACCT 3'. F0 mice were selected to mate with wild type C57BL/6J mice, and F1 mice were obtained and genotyped. Homozygous Fsip1 null (Fsip1 –/–) mice were produced by mating between Fsip1+/- heterozygous mice.
Fertility assessment
To examine the Fsip1−/− mice fertility. We cohabited a sexually mature Fsip1–/– male mouse (8-12 weeks old) with two virgin wild-type (WT) female mice for more than one month, and checked the vaginal plug every morning. Normal mating behavior was indicated if vaginal plug was observed, then the female mouse was placed in a separate cage, and another female mouse was placed in the cage for another round of mating. The male was deemed as infertile if it didn’t show evidence of mating (presence of copulatory plug) or induced pregnancy after two months of co habitation. The female mice were euthanized to confirm the lack of pregnancy at the end of the two months. Fertility test was performed on at least 10 mice of each genotype.
Evaluation of sperm motility and morphology
Sperm quality parameters including sperm concentration, and progressive sperm motility were evaluated according to WHO standard. Cauda epididymis were collected immediately from adult male mice after euthanization, and washed with PBS, then several incisions were made and placed in 1 ml of Sperm Rinse™ medium (Vitrolife). The Cauda epididymal spermatozoa were released for evaluation by the swim-up method for 30 mins at 37°C, and then the supernatant was collected in a clean tube. For sperm motility assessment, 10 µl of the supernatant was placed in Makler chamber, and examined under phase contrast microscope using Computer-assisted semen Analyzer (CASA) system (Microptic S.L.).
Scanning electron microscope
Sperm morphology was evaluated by scanning electron microscope (SEM). Briefly, sperm samples were isolated as described above, washed in PBS, and fixed overnight at 4°C in 2.5% glutaraldehyde and 2% paraformaldehyde in 0.15 M sodium phosphate buffer. Then the sperm was washed and collected on nucleopore filters or glass cover slip, dried at critical point, and coated with gold/palladium. Samples were examined at 20 KV using HITACHI S-3000N scanning electron microscope.
Transmission electron microscope
Testis and sperm were fixed with 2.5% glutaraldehyde in 0.2 M cacodylate buffer overnight, washed with 0.2 M PBS, then the tissues were cut into about 1 mm3, and soaked in 1% OsO4 in 0.2 M cacodylate buffer for 2 h at 4°C. The samples were dehydrated in a series of graded ethanol and embedded in resin. Ultrathin sections were cut using an ultramicrotome, stained with uranyl acetate and lead citrate, and observed using HITACHI H-7500 transmission electron microscope at 80 kV.
Sperm immunostaining
The cauda epididymal spermatozoa were isolated as described early, and smears were made on clean glass slides, allowed to dry in air, and fixed with 4% PFA or 95% ethanol, permeabilized with freshly prepared 0.3 % Triton X-100 in PBS, blocked with 10% goat serum for 1 hour at RT, and then incubated overnight at 4 °C with optimal dilution of primary antibody diluted in blocking buffer (Table S1). On the second day, the slides were allowed to stand for 1 hr at RT, washed with PBS, and then incubated with Secondary Antibody Alexa Fluor 488 Goat anti-Rabbit IgG (H+L) for 1 hr at RT. Finally, the slide was washed and mounted using anti-fade mounting media with DAPI. In order to observe the sperm midpiece (mitochondria) the sperms were stained with Mito-tracker Deep Red (Invitrogen, USA). For the co-distribution of two different proteins, we used two antibodies from different species (e.g., Rabbit anti mouse target 1 and mouse anti mouse target 2, if the target is mouse protein), and a mixture of two secondary antibodies raised in different species (with two different fluorochromes). The images were captured with a high magnification fluorescence microscope or confocal microscope (Leica Microsystems).
Duolink proximity ligation assay
The proximity ligation assay (PLA) was conducted using Duolink In Situ reagents (Sigma, USA). Briefly, sperm cells were fixed and incubated with rabbit anti-Fsip1 and mouse anti-Acrv1 antibodies. Then a pair of oligonucleotide-labeled anti-rabbit and anti-mouse PLA probes used to label the primary antibodies, if the two proteins in close proximity a PLA red fluorescent signals will be generated. Finally, the slide washed and mounted using anti-fade mounting media with DAPI. The images were taken using confocal microscope (Leica Microsystems).
Testicular tissue processing and morphological evaluation
Testis/ epididymis tissues were excised and fixed in modified Davidson's Fluid (mDF) (ServiceBio, Wuhan, China). The tissues were dehydrated in ascending grades of ethanol, and embedded in paraffin. Then 5 µm thick sections were prepared. For histological evaluation, sections were stained with hematoxylin-eosin according to the manufacturer’s instructions. PAS staining was used to stain the testicular sections with periodic acid solution and Schiff’s reagent (Cat# 395B, Sigma-Aldrich). Histology and morphology were observed and captured using PANNORAMIC slide scanners (3DHITECH, Hungary), and images were processed and exported using CaseViewer™ (version 2.4).
Tissue immunostaining
Paraffin fixed sections were hydrated in descending grades of ethanol, then antigen retrieval carried out using citrate buffer (pH = 6) in low heat microwave for 20 mins. Then slides were permeabilized with 0.3% Triton X-100, blocked with 10% goat serum at RT for 1 hr, and incubated overnight with primary antibodies in humidity chamber at 4 °C (Table S1). The slides were then allowed to stand for 1 hr at RT, followed by two washes with PBS for 5 mins, then incubated with stages marker fluorescence lectin, followed by the secondary antibody (Goat anti-rabbit Alexa Fluor 488 or 568), and mounted with fluoroshield medium with DAPI (Cat# ab104139, abcam). PANNORAMIC slide scanner was used to acquire images (3DHITECH, Hungary), and CaseViewer software was used to process and export images (version 2.4).
Immunoprecipitation (IP) and Co-immunoprecipitation (CO-IP)
For investigating the protein-protein interaction, we used Pierce Classic Magnetic Immunoprecipitation (IP) and Co-immunoprecipitation (CO-IP) kit (Cat # 88804, Thermo Scientific, USA). Briefly, the testes were homogenized with lyses buffer containing PMSF and cocktail protease inhibitors. Then about 1500 µg protein was incubated with 5μg of IP antibody (Table S1) or IgG (as a negative control) overnight at 4ᵒC on rotator, followed by incubation with A/G magnetic beads for one hour at RT. Finally, the mixture was washed and eluted. The whole cell lysate (Input) and the immune-precipitant or IgG was subjected to western blotting to confirm the interaction.
Fertility assessment
The fertility was tested for each genotype using adult male mice (8–12 weeks). Briefly, a male mouse was caged with two wild-type (WT) females mice. Vaginal plug was checked every morning, and once a vaginal plug was identified (day 1 post coitus), the female with vaginal plug was placed in a separate cage, and the male was allowed to rest for 2 days. Another female was placed in the cage for another round of mating. The female was deemed as not pregnant if it didn't generate any pups by day 22 post coitus, and it was euthanized to confirm the lack of pregnancy. For each gender and genotype, at least 20 mice were tested.
Sperm viability, motility and morphology assessments
Cauda epididymal sperm were collected immediately from adult male mice after euthanization and washed with PBS. Then the sperm were released by making an incision in the epididymal tissue, placed in Sperm Rinse medium (Vitrolife), and allowed to swim up for 30 mins at 37°C. Sperm viability and motility was examined using the Automatic Sperm Cytomorphology Analyzer (CASA) system with phase contrast microscopy (Microptic S.L.). Papanicolaou staining of sperm was performed following the manufacturer’s instructions (Cat# DA0191, Leagene Biotechnology).
Sperm immunostaining
The cauda epididymis sperm were isolated as described above, fixed with 4% PFA or 95% ethanol, permeabilized with freshly prepared 0.3 % Triton X-100 in PBS, blocked with 10% goat serum for 1 hour at 37 °C, and then incubated with primary antibodies (Table S1) with optimal dilution overnight at 4 °C. The slides were allowed to stand at RT for 1 hr, washed and then incubated with Secondary Antibody Alexa Fluor 488 Goat anti-Rabbit IgG (H+L) for 1 hr at RT. Finally, the slides were washed and mounted using anti-fade mounting media with DAPI. The images were captured at high magnification using fluorescence microscope with phase contrast channel (Leica Microsystems).
Assessment of length of midpieces and principal pieces of sperm
To estimate the length of midpieces and principal pieces of sperm of the OE and WT mice, we applied immunostaining method as described above in combination with phase contrast microscopy. The midpiece and the principal piece were stained with Mito Track (red) and Akap4 antibody (green), respectively. The measurement was performed using Leica microscopy images processing and quantification tools. At least 100 sperms from each sample were used to estimate the length.
Testis tissues processing and morphology assessment
Testis tissues were surgically removed and fixed in modified Davidson's Fluid (mDF) (ServiceBio), dehydrated in ascending grades of ethanol, and embedded in paraffin. Then 3-4 μm thick histologic sections were prepared. For the histological assessments sections were stained with hematoxylin-eosin according to the standard protocol. PAS staining was also conducted on sections from the testis using periodic acid solution and Schiff’s reagents (Cat# 395B, Sigma-Aldrich). The morphology was observed and captured using PANNORAMIC slide scanners (3DHITECH, Hungary), the images was processed and exported using CaseViewer (version 2.4).
Tissues immunostaining
Paraffinized fixed testicular tissue sections were hydrated in descending grades of ethanol, followed by antigene heat activation using citrate buffer (pH = 6) for 20 mins. Then the slides were permeabilized with 0.3% Triton X-100, blocked with 10% Goat serum for 1 hr at RT and incubated with primary antibodies (Table S1) overnight at 4 °C. Then the slides were allowed to stand for 1 hr at RT, followed by two washes with PBS for 5 mins, incubated with the secondary antibody (Goat anti-rabbit Alexa Fluor 488 or 568), and mounted with fluoroshield medium with DAPI (Cat# ab104139, abcam). Images were acquired using a fluorescence microscope (Leica).
RNA-seq library preparation for 10X Genomics single cell sequencing
Testes of WT, KI and OE mice were isolated and dissociated into single cell suspensions as previously described [30]. Three mice were used for each genotype. Briefly, the testis was excised and the tunica albuginea was removed. Seminiferous tubules were digested with Collagenase IV (Cat# C5138, Sigma Aldrich), Trypsin from bovine pancreas (Cat# T9201, Sigma Aldrich) and DNase I from bovine pancreas, lyophilized (Cat# 14365, USB), filtered, and resuspended. For each sample and prepared libraries, ∼5,000 cells were loaded into 1 channel of the Chromium system according to the protocol of 10X Genomics. The sequencing process was conducted on an Illumina HiseqX machine in a paired-end 150 bp mode.