Behavioral tests
All behavioral tests were carried out on both male and female mice at 8 weeks of age, and the balanced gender was kept for all the genotype mice. Each test was conducted at fixed day time (between 8:30 am to 18:30 pm) on each training day. Mice were moved to the testing room 1 h before behavioral testing for acclimation, and those participating in multiple tests were allowed to rest for at least 3 days between two tests. All experimental areas were cleaned with 70% ethanol before the tests and between subjects. All behavioral tests were carried out with the presence of two researchers blinded to the genotype.
Morris water maze test
Morris water maze test was performed to investigate the learning and memory ability of mice. Briefly, a platform was placed at the central zone of one quadrant of the pool below the surface of water. The mice were trained to learn the position of the hidden platform for 4 days. At day 5, the platform was removed. The mice were released into water and allowed to swim for 60 s to search a virtual quadrant centered on the location of the platform. Duration in zone of platform refers to amount of time mice remained in this virtual zone. Frequency of crossing platform refers to number of times mice crossed the virtual zone, while latency to first arrival refers to the time needed for mice to reach the virtual zone at first time, while distance travelled in target quadrant refers to the distance mice swam in the virtual quadrant. Videos were recorded and analyzed by using the SuperMaze V2.0 software (XinRuan, Shanghai, China).
Rotarod test
Rotarod test was performed to indicate motor coordination of mice in each group. Firstly, mice were trained three times at the rate of 30 rpm before test, and each training maintained for 5 min. In the test, the rotation rate increased gradually to reach 40 rpm within 300 s. The test was over when a mouse fell off. Each mouse was detected for 3 times and the mean latency time at rotarod was recorded.
Grip strength test
Grip strength of mice forelimbs was measured with a grip strength test meter (BIOSEB, EB Instruments). During the test, the mice were placed over the grid allowing only forepaws to attach to the grid. After the mice paws grasped the grid, their tails were pulled horizontally until they completely released hold. Each mouse was tested for three times. The readings of grip strength and duration of grasping the grid were recorded and analyzed by using the SuperGSM software (XinRuan, Shanghai, China).
Tissue preparation
Mice were anaesthetized with 50 mg/kg sodium pentobarbital. After perfused with 0.9% NaCl and 4% paraformaldehyde, brains were extracted and post-fixed for 24 h, followed with dehydration by using sucrose. Brains were cut into two hemispheres, and then serial sagittal sections (30 μm thick) were sliced with freezing microtome (CM3050S, Leica, Germany).
Nissl staining
Sections were immersed into 75% ethanol (30 s), dH2O (30 s) and cresyl violet (2 min). Then, sections were dehydrated with gradient ethanol (75%, 95%, 100%) for 30 s respectively, followed by incubation with xylene and mounted with neutral resins. The images were taken under an inverted microscope.
5-Ethynyl-2’-deoxyuridine labeling
For proliferation assays, pregnant dams on E13.5 were intraperitoneally injected with 5-Ethynyl-2’-deoxyuridine (EdU, 20 mg/kg body weight) 2 h before sacrifice. Embryonic brains were harvested, fixed in paraformaldehyde and immersed in 30% sucrose for dehydration. Brain slices were then stained with Click-iT EdU Imaging Kits (C10339, Invitrogen, Thermo Fisher Scientific, USA). Cells incorporated with EdU were determined under a fluorescence microscope. Percentage of EdU+ fluorescence area (indicating the cell number of EdU+) of E13.5 mouse brain cortex was calculated in 3 random fields per coverslip. For migration assays, pregnant dams on E15.5 were intraperitoneally injected with EdU. Brains were harvested after 72 h and stained as above.
Immunostaining
The normal brain tissue microarrays (BNC17011, Biomax, MD, USA) were prepared. According to the instruction from Biomax official website, BNC17011 were derived from normal brain tissue of male or female at the age of 2 to 50, including brain regions such as frontal lobe, apical lobe, occipital lobe, temporal lobe, midbrain, pons, medulla oblongata, thalamus opticus, cerebellum, hippocampus, callositas, optic nerve, and spinal cord. The slides were immersed in xylene and graded ethanol to deparaffinize and rehydrate. After antigen retrieval using microwave with sodium citrate buffer, 0.3% Triton-X-100 was added to permeabilize the tissue. The slides were blocked with goat serum and incubated with primary antibodies at 4 ℃ overnight. After washing with PBS, the sections were incubated with secondary antibodies. For mouse brain tissues, the perfused brain samples were fixed within 4% paraformaldehyde (PFA) in 0.01 M PBS at 4 ℃ for 24 h, then washed by PBS twice , cryoprotected with sucrose gradients, snap frozen, and sectioned with a cryostat (Leica, Wetzlar, Germany) to thickness of 30 µm. Then the sections were immuno-stained by using aforementioned methods, except deparaffinization and rehydration. Number of Cux1+ or Foxp2+ cells in frontal cortex and motor cortex were counted on three sagittal cerebrum sections, respectively. Gfap+ and NeuN+ cells in different brain regions were counted in 3 random fields per section. Data were obtained from at least three independent experiments and analyzed with ImageJ software.
To determine the number of matured neurons in brain cortex, sections were permeabilized with 0.3% Triton X-100 and blocked with goat serum for 1 h at room temperature, followed by incubation with mouse anti-NeuN antibody at 4 °C overnight. After washing, HRP-conjugated anti-mouse IgG secondary antibody was applied to the sections for 1 h at room temperature. Nuclei were stained using 4,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific).
To examine the neurogenesis of NPCs, cells were immersed in 4% PFA for fixation, 0.3% Triton X-100 for permeabilization, and then blocking. Cells were incubated with mouse anti-β-III tubulin antibody and rabbit anti-ki67 antibody overnight, followed by secondary antibodies. To observe the synaptic formation, GFP-positive cells were co-staining with Psd-95 as above. Immunostaining of pH3 in primary cells exposed to EdU was also performed as above. Data were obtained from at least three independent experiments and analyzed by ImageJ software.
In order to visualize and measure the cholesterol level, Filipin staining was performed in tissue sections (10µm thick) by using a cell-based Cholesterol Assay Kit (ab133116, Abcam, UK). Briefly, the tissue sections were washed (3 × 5 min) with Cholesterol Detection wash buffer, and then the Filipin III was added to each section and incubated in the dark for 60 min at room temperature. After washing, the fluorescence images were obtained by a Leica DMi8 (Leica Microsystems, Wetzlar, Germany) fluorescence microscope by using × 20 HC PL FLUOTAR objective.
Western blot analysis
Total protein was extracted from peripheral blood using cell lysate containing RIPA and protease inhibitor cocktail. And the brain tissues were lysed with 2% SDS in PBS with PMSF and proteinase inhibitor cocktail. The BCA assay was used to determine protein concentration. Proteins were resolved on 7.5%, 10% or 15% tris-glycine gels based on different molecular weight and transferred to PVDF membranes. After blocking, the membranes were incubated with primary antibodies, followed by horseradish peroxidase (HRP)-labeled secondary antibodies. Then, blots were visualized by West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, MA, USA) and scanned using ChemiDocTM MP system (Bio-Rad, CA, USA). Densitometries of individual blot signals were quantified using ImageJ software.
Culture of primary neurons
E13.5 mouse embryo brains were taken out from pregnant dam. Cortex in each brain was dissected separately and collected in Hibernate-E supplemented with 2% B27 on ice. Single cells were obtained by using 0.05% trypsin (containing 0.2 mM EDTA) digestion for 10 min at 37 ℃. After filtration with 70 μm strainer and centrifugation, cells resuspended in Neurobasal medium with 2% B27 Plus Supplement, 0.25% Glutamax and 25 μM glutamate were placed in poly-D-lysine coated plates. Adherent neurons were prepared for EdU and TUNEL staining. To prepare migration assay, isolated cells were initially cultured in ultra-low attachment plates to form neurospheres, which could be digested by using 0.05% trypsin without damage of neurites.
Proliferation and apoptosis assays of primary neurons
At 2 DIV, cells were labeled with 10 μM EdU solution and incubated for 4 h. Cells were treated by using 4% PFA, followed by 0.5% TritonX-100 permeabilization. After being washed twice with 3% BSA, cells were incubated with Click-iT reaction cocktail according to protocol of Click-iT EdU Imaging Kits (C10339, Invitrogen, Thermo Fisher Scientific, MA, USA) and stained with DAPI. Dead cells were labeled using In Situ Cell Death Detection Kit, POD (11684817910, Roche, Switzerland).
Migration test of primary neurons
Neurospheres were digested with 0.05% trypsin to obtain single neurons and resuspended in Neurobasal Medium with 1% B27 Plus Supplement. Cells were seeded on the upper layer of a cell culture insert with PET track-etched membrane (8 μm pore size, 353097, Corning, NY, USA) at density of 1 × 105 cells/well. Neurobasal Medium with 2% B27 Plus Supplement was added into the bottom of the lower chamber. After 16 h, the culture insert was taken out and the medium was removed carefully. Cells on the upper surface were wiped, while migrating cells in pore and on the lower surface of membrane were fixed, stained with 0.1% crystal violet and observed.
Flow cytometry
Whole brain tissues from mice on P1 (postnatal day 1) were collected, including brain tissues of their wild-type littermate. After digestion with 4 mg/ml papain and 0.1 mg/ml DNase in 37 ℃ shaker for 30 min, suspension was diluted using DMEM/F12 medium containing 5% FBS and filtered with 70 μm strainers. Then, suspension was centrifuged and the cells were fixed in 4% PFA. 0.3% Triton-X100 was used for permeabilization. After being blocked with 5% goat serum, cells were incubated with mouse anti-Gfap antibody and rabbit anti-Ki67 antibody or rabbit anti-Caspase-3 antibody at 4 ℃ for 1 h. Cells were washed with DPBS and incubated with Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 647 goat anti-rabbit IgG at 4 ℃ for 30 min. After being washed for two times, cells were suspended by using DPBS and analyzed on the flow cytometer (BD FACSCanto, BD Biosciences, CA, USA).
Measurement of phosphatidic acid (PA)
Phosphatidic acid was measured by using the PicoProbeTM Phosphatidic Acid Assay Kit (BioVision, CA, USA). In brief, medulla of wild-type and Gpam-/- mice was homogenized in PA assay buffer. Lipid extraction was obtained according to the protocol and solubilized in 5% Triton X-100 solution. “Sample background control” and “Sample” were prepared in parallel. Standard curve was generated by using PA standard solution. Converter mix was only added in sample and standard wells. All wells were incubated at 45 ℃ for 1 h. Reaction mix was added in each well and incubate at 37 ℃ for 30 min. Fluorescence was recorded at Ex/Em = 535/587 nm and PA concentration was expressed as nmol PA per mg tissue weight. Value of PA concentration was normalized.
Measurement of phosphatidylcholine (PC)
Phosphatidylcholine was measured by using the phosphatidylcholine assay kit (Abcam, UK). For each individual, about 10 mg brain tissues were washed with cold PBS, resuspended in the assay buffer, and homogenized on ice. After 10 min incubation, samples were centrifuged for 5 min at 4 °C at 16,000 g. The supernatant was incubated with the reaction mix including OxiRed Probe supplemented with hydrolysis enzyme for 30 min. The colorimetric reading was measured at OD570 nm on a microplate reader.
Measurement of Phosphatidylethanolamine (PE)
Phosphatidylethanolamine was measured by using the phosphatidylethanolamine assay kit (Abcam, UK) according to the manufacturer’s instruction. Briefly, solubilized lipids were extracted from brain tissues with 5% Triton X-100, incubated with converter mix at 45°C for 1 hour, and then with reaction mix at 40 °C for 3 hours. Fluorescence was recorded at Ex/Em 535/587 nm.
Fragile-X screening and mitochondrial genome sequencing Fragile-X screening
We performed the fragile X screening for the gene of FMR1 on 120 families including patients, unaffected siblings, and parents. Fragile-X syndrome (FXS) is the most common monogenic form of ID and ASD, predominately due to the expansion of a CGG repeat located at the 5’ UTR of the FMR1 gene (OMIM: 309550). Expansion to the full mutation (more than 200 repeats) leads to hypermethylation and silencing of FMR1, resulting in the absence of its protein product, FMRP, which causes FXS. A FMR1 CGG repeat was amplified with the primers (Forward: 5’ GCGCTCAGCTCCGTTTCGGTTTCACTTCC and Reverse: 5’ CCCAAGTCCAGTCCTTCCCTCCCAACAACA) by using the LA Taq polymerase kit (RR02BG, TaKaRa, Shiga, Japan) and 50 ng of total genome DNA, then the PCR products were analyzed by gel electrophoresis and Sanger sequencing. Thermal cycling was as follows: denaturation at 96 °C for 3 min and 10 cycles of 98 °C for 20 sec, 65 °C for 45 sec, and 72 °C for 3 min, followed by 22 cycles of 98 °C for 20 sec, 68 °C for 3.5 min, and a final extension at 68°C for 10 min 1. There is no full mutation observed in this cohort.
Mitochondrial genome sequencing
We conducted very-high-coverage (6,000X) mitochondrial DNA sequencing for all CP patients. The 16.6 kb circular mitochondrial genome encodes 13 protein subunits of the electron transport chain, 22 tRNA and 2 rRNA genes 2. The mitochondrial genome was amplified by a single-amplicon LR-PCR using a LA Taq polymerase kit (RR02BG, TaKaRa, Shiga, Japan) and 100 ng of total genome DNA 3. Indexed paired-end DNA libraries were prepared and sequenced by Nextseq500 sequencer (Illumina, CA, USA), according to the manufacturer instructions. The sequenced data was analyzed by the NextGENe (SoftGenetics, State College, PA) with the mitochondrial reference sequence (NC_012920). The average sequencing coverage of mitochondrial genome was 6,000X, and the variants with abundance >2% were reported, because of the well-known heteroplasmy of mitochondrial variants. The pathogenicity of a specific variant was defined according to the guideline recommended by the American College of Medical Genetics and Genomics (ACMG). The pathogenic mitochondrial variants were validated by PCR and Sanger sequencing of the total DNAs from the patients and the biological mothers.
High-density cytogenetic microarray
High-density cytogenetic microarrays for all CP patients were performed by using the CytoScan HD Array platform (Affymetrix, CA, USA) with more than 2.6 million markers including 0.75 million single nucleotide polymorphisms. CNV detection was done by using the Chromosome Analysis Suite (version 3.0, Affymetrix, CA, USA). The genomic coordinates were based on the Human Genome Build GRCh37/hg19. Pathogenic CNVs and likely pathogenic CNVs were defined as the rules recommended by the American College of Medical Genetics and Genomics guidelines (ACMG). CNVs were compared in the Database of Genomic Variants (http://dgv.tcag.ca/dgv/app/), CAGdb (Cytogenomics Array Group Database) (http://www.cagdb.org/), ISCA (International Standards for Cytogenomic Arrays) (http://dbsearch.clinicalgenome.org/), DECIPHER (https://decipher.sanger.ac.uk/), and an in-house 2,247 control samples. Pathogenic and likely pathogenic CNVs were confirmed in the patients and parental samples using a SYBR Green-based real-time quantitative PCR assay (A25778, Thermo Fisher Scientific, MA, USA).
Analysis of cell viability and adhesion
Cell viability was examined with CCK-8 detection kit (Doindo, kumamoto, Japan). Cells in each group were seeded into 96-well plate at a density of 5 × 104 cells/well. After 12 h, medium was removed. 100 μl CCK-8 working solution (1:10 in medium) was added in each well. Cells were incubated for 4 h. Cell viability which reflected cell proliferation was detected by OD450 with a microplate reader. In adhesion experiment, 96-well plates were coated with matrigel (Corning, NY, USA). SH-SY5Y cells in the wild-type and TYW1-KO groups were both divided into control part and experiment part. Medium was added in background part. Plates were incubated at 37 ℃ for 1 h. In experimental part, cells were washed three times by using washing buffer. Then, staining solution (1:10 in medium) was added in control part, experimental part and also in background part. After 4 h, OD450 was measured. The adhesion rate was calculated as following: the adhesion rate of cells (%) = (OD450 of experimental part – background) / (OD450 of control part-background) × 100. Measurement was recorded on three independent experiments.
Detection of cell migration
Cells in each group were seeded on 6-well plates at a density of 2 × 106 cells/well. After reaching 90% confluence, a straight scratch wound was made using a pipette tip. Then, cells were washed with PBS to remove suspended cells gently and added with new medium. At 0 h, 24 h and 48 h, the wound area was observed under microscope. At 48 h, wound in the wild-type group almost closed. The cell migration was quantified according to the wound area at 48 h relative to the initial wound area by the ImageJ software. Measurement was recorded on three independent experiments.
Induction of cell differentiation
Cells in each group were seeded on 24-well plates coated with matrigel (Corning, NY, USA). After 24 h, 10 μM all-trans retinoid-acid (RA) (Stemcell technologies, Vancouver, Canada) was added to induce the cell differentiation. At day 5 in the presence of RA, cells were treated with 50 ng/ml BDNF (Stemcell technologies, Vancouver, Canada) in DMEM without serum. Morphology of cells was observed by using immuno-staining of MAP2 at day 10. Neurites were traced with the NeuroGrowth plugin of ImageJ software to examine the number and total length of branches. Measurement was recorded on three independent experiments.
Tissue preparation
Mice at 6 weeks of age were anaesthetized with 50 mg/kg sodium pentobarbital. After perfused with 0.9% NaCl and 4% PFA, brains were harvested and fixed in 4% PFA overnight, followed with dehydration by 15% and 30% sucrose. Sagittal brain sections (30 μm thick) were prepared using freezing microtome (CM3050S, Leica, Germany).
Golgi staining
Brain tissue prepared for Golgi staining was performed by using FD Rapid GolgiStainTM kit. According to manufacturer’s instruction, tissue was immersed in Solution A/B at room temperature for at least 24 h, followed by Solution C. All procedures should be protected from light. Samples embedded in OCT compound were then sectioned coronally (30 μm thick). For staining procedure, sections were placed in Solution D/E for 10 min. After washing, sections were dehydrated in 50%, 75%, and 95% ethanol, followed by 100% ethanol 4 times for 4 min each rinse. Sections then were cleared by xylene and mounted. The confocal imaging was achieved using a TCS-SP8 LSM confocal imaging system (Leica, Wetzlar, Germany).
Quantification of the m6A
The m6A level of brain cortex was measured using m6A RNA Methylation Quantification Kit (Colorimetric). In brief, total RNA of brain cortex was isolated using TRIZOL reagent (Invitrogen, Thermo Fisher Scientific, USA). 100 -300 ng total RNA per reaction was added into the wells filled with 80 μl Binding Solution. After incubation at 37 °C for 90 min, wells were washed with 1X Wash Buffer. m6A RNA was then captured using Diluted Capture Antibody, following by Diluted Detection Antibody and Diluted Enhancer Solution. Developer Solution was added to each well and incubated for 1-10 min away from light. Signal was detected on a microplate reader at 450 nm.
m6A-sequencing
Total RNA was isolated from the cortex samples of the WT and KO mice and purified using TRIzol reagent following the manufacturer's procedure. The RNA integrity was determined and confirmed using Bioanalyzer 2100 (Agilent, CA, USA) with RIN number >7.0 and electrophoresis with denaturing agarose gel, respectively. Using Dynabeads Oligo (dT) 25-61005 (Thermo Fisher, CA, USA), Poly (A) RNA was purified from 50 μg total RNA under two rounds of purification. Under 86°C, the poly (A) RNA was fragmented into small pieces using Magnesium RNA Fragmentation Module (NEB, cat. e6150, USA) for 7 min. m6A pull-down was performed using m6A-specific antibody (No. 202003, Synaptic Systems, Germany) in IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% Igepal CA-630) for 2 h at 4 °C. Next, the IP RNA was reverse-transcribed to cDNA, followed by synthesis of U-labeled second-stranded DNAs with E. coli DNA polymerase I (NEB, cat.m0209, USA), RNase H (NEB, cat.m0297, USA) and dUTP Solution (Thermo Fisher, cat. R0133, USA).
An A-base was then added to the blunt ends of each strand, which was prepared for ligation to the indexed adapters. Single- or dual-index adapters were ligated to the fragments; size selection was performed with AMPureXP beads. After the heat-labile UDG enzyme (NEB, cat.m0280, USA) treatment, the ligated products were amplified with PCR. The average insert size for the final cDNA library was 300 ± 50 bp. The 2 ×150 bp paired-end sequencing (PE150) was performed on an illumina Novaseq™ 6000 (LC-Bio Technology CO., Ltd., Hangzhou, China).
Cell culture
Primary mouse NPCs were isolated from Arhgef2 wild-type and knockout mice embryonic cortices at E13.5 and cultured in Neurobasal medium (Gibco, CA, USA) containing 2% B27 (v/v, Gibco), 0.25% Glutamax, and 25 μM glutamate. Cells were seeded on dishes precoated with poly-D-lysine. To measure neuro-spheres, NPCs were cultured in ultra-low attachment plates and the size pf spheres was analyzed by Image J. The experiments of neurogenesis were performed on density-matched NPCs cultures within the first 4 days, while the experiments related to synaptic formation were conducted in well-matured neurons at day 14. For the overexpression of Mettl14 or Npdc1, transfection of Lenti-Mettl14/GFP and Lenti-Npdc1/GFP (at MOI 10) (Hanbio Biotechnology, Shanghai, China) respectively to Arhgef2 -knockout primary cells was performed. Lenti-GFP was transfected to wild-type and Arhgef2 -knockout cells as control.
Neurite outgrowth analysis
Neurite outgrowth of GFP-positive cells was measured using Image J combined with Neuron J and Sholl Analysis plugin. A vertical line from the soma to the tip of the longest branch was drawn to defined as the length of neurite. the number of branches was examined by counting the intersections of neurites and concentric circles. The radius interval between circles was 10 μm per step, ranging from 10 μm to the tips of the longest branch.
RNA immunoprecipitation (RIP)
After transfection of lentivirus for 3 days, m6A modification on Npdc1 and Cend1 mRNA was detected using Imprint RNA Immunoprecipitation (RIP) Kit. In brief, cells (1-2 X 106 each reaction) were collected in mild lysis buffer supplemented with protease inhibitor cocktail, 1 M DTT and 40 U/μl ribonuclease inhibitor. After incubation on ice for 15 min, the lysis reactions were centrifuged for 10 min at 16,000 g at 4 °C, and supernatant was collected. 10% of RIP lysate supernatant per reaction was labelled as Input. Each reaction was then incubated with 2 μg of anti-m6A antibody-prebinding protein A magnetic beads on a rotator overnight. 2 μg of IgG antibody was used for negative control. m6A-tagged mRNA was eluted by IP buffer and purified using TRIZOL reagent. SYBR-green based qRT-PCR was performed as described above.